Mitochondrial DNA

The left domain of the control region was amplified using primers tRNAPro (Stewart and Baker 1994a) and PS-CD (5' - GGCGAGATTAAATGTTAGCTGG - 3'). PCR reactions consisted of 2 ml of DNA (40-200 ng/ml), 1.5 ml (0.375 mM; Sigma Aldrich) of forward and reverse primer and 45 ml of MegaMix~Blue (Microzone Ltd.). PCR amplification was carried out in a Peltier Thermal Cycler (MJ Research) using an initial denaturation of 95°C for 3 min followed by 30 cycles of 95°C for 45 s, annealing temperature of 60°C for 1 min, and an extension of 72°C for 90 s. This was followed by a final extension step of 10 min. Fragment sizes ranged from approximately 500-800 bp, depending on the number of tandem repeats as previously reported in other Sorex species (Stewart and Baker 1994a; Fumagalli et al. 1996).

Was this article helpful?

0 0

Post a comment