Generating the pEEmuFc Master Expression Vector

1. pSK/muFc vector (obtained from the Epstein laboratory).

2. muFc primers: FWD muFc:

5'CCCTATAAGCTTCGrACGGAGCCCAGAGGGCCCACAATC (HindIII site; BsiWI site; Hinge region) REV muFc:

5'ATCAATGAATTCTCACGCGGCCGCTTTACCCGGAGTCCGGGAGAA (£coRI site; NotI site; CH3 region)

3. pEE12 GS expression vector (NS0 cells included; Lonza Biologics).

4. HindIII restriction enzyme (RE) (10X NEBuffer 2 included; NEB, cat. no. R0104S).

5. £coRI RE (10X NEBuffer £coRI included; NEB, cat. no. R0101S).

6. Montage PCR filter units (Millipore, cat. no. UFC7PCR50).

7. T4 DNA ligase (10X ligation buffer provided; NEB, cat. no. M0202S).

8. XL1-Blue Escherichia coli bacteria (Stratagene, cat. no. 200268).

10. Bacterial shaker capable of 150 rpm.

11. Luria broth (LB), prepared according to manufacturer (Sigma, cat. no. L7658).

12. Ampicillin (Amp; Sigma, cat. no. A9518): prepare 25 mg/mL stock in sterile dH2O.

13. LB plus Amp (LB/Amp): dilute Amp stock 1:250 in sterile LB.

14. LB agar plates plus Amp 100 p,g/mL, prepared according to manufacturer (Sigma, cat. no. L7533).

15. Bacterial incubator, 37°C, nonhumidified.

16. Polypropylene round-bottom 14-mL tubes with caps (BD Falcon, cat. no. 352059).

17. Toothpicks, wooden, autoclaved.

18. Wizard Plus SV Miniprep kit (Promega, cat. no. A1330).

19. pSK/muFc vector map file (obtained via email from the Epstein laboratory).

0 0

Post a comment