Solubilizing Fc Fusion Proteins

The purpose of this chapter is to describe in depth how to genetically engineer, stably transfect, screen, produce, and purify Fc fusion proteins. A general outline of the following procedures is depicted in Fig. 1. Expression of soluble Fc fusion protein is entirely dependent on a mammalian expression system. The protein expression system described here involves the usage of an expression vector (pEE12) that is under the control of a strong viral promoter (6). The viral promoter enables the coexpression of the Fc fusion protein with glutamine syn-thetase. Transfectants that maximally express the Fc fusion protein in addition to glutamine synthetase are positively selected using a murine myeloma cell line (NS0), which expresses insufficient amounts of glutamine (7,8). Finally, utilizing a simple screening technique, such as enzyme-linked immunosorbent assay (ELISA), allows the investigator to identify productive transfectants, which can be grown in large-scale culture (9) for subsequent chromatographic purification. By these methods, the investigator is provided with a reliable and efficient method for solubilizing proteins of interest.

PCR amplify protein moiety

Insert muFc into pEE12 using Hind\\\ and EcoR1 Insert amplified protein moiety into pEE12/muFc Perform stable transfection using NSO cell line Screen clones that produce P/Fc by ELISA

|Grow high producing clones to large scale | | Purify P/Fc fusion protein using Protein A column|

|check purity and verify activity of Fc fusion protein |

Fig. 1. Overview describing how Fc fusion protein is expressed and produced on a large scale. The final "transfection vector" is transfected for expression in the murine myeloma NS0 cell line. Expression of Fc fusion protein is verified by moiety-specific ELISA. The highest-producing clone is then grown to large scale for purification.

2. Materials

2.1. Cloning the Protein Moiety

1. cDNA encoding the protein of interest.

2. MacVector or DSGene DNA sequence analysis software (see Note 1).

3. Templates for designing target primers:

FWD target:

5' CGTAAGCTTGCCGCCACCATGGGXXXXXXXXXXXXXXXXX (Hindlll site; Kozak sequence; X17 = bp at 5'-end of target)

REV target:

5' TAACGTACGXXXXXXXXXXXXXXXXXXXXX (BsiWI site; X21 = bp at 3'-end of target)

4. Thin-walled PCR tubes, autoclaved (Bio-Rad, cat. no. 223-9473).

6. 200 U Vent polymerase (10X PCR buffer included) (NEB, cat. no. M0254S).

7. Milli-Q deionized water (dH2O), autoclaved.

8. PCR thermal cycler.

12. 0.5 M EDTA: dissolve 18.6 g in dH2O, adding NaOH to dissolve. Adjust to pH 8.0; bring to 100 mL total volume with dH2O.

13. 5X Tris-borate-EDTA (TBE) buffer: 54 g Tris base, 27.5 g boric acid, and 10 mL of 0.5 M EDTA, pH 8.0.

14. Glycerol (glycerin; Fisher, cat. no. G33-500).

15. Bromophenol blue (Bio-Rad, cat. no. 161-0404).

16. 6X Glycerol buffer: 7 mL of 0.5X TBE pH 8.0,3 mL glycerol, and 25 mg bromo-phenol blue.

17. Agarose, molecular biology grade (Fisher, cat. no. BP1356-100).

18. Ethidium bromide (EtBr) prepared at 10 mg/mL (Sigma, cat. no. E8751) (see Note 2).

19. 1% Agarose gel: mix 0.5 g agarose + 50 mL of 0.5X TBE buffer in an Erlenmeyer flask, and boil in microwave until dissolved (<1 min). When mixture reaches 60°C, add 2 pL EtBr, swirl to mix, and pour.

21. Ultraviolet (UV) transilluminator (Fotodyne or similar).

22. Sterile scalpels (VWR, cat. no.100229-885).

23. QiaQuick PCR Gel Extraction Kit (Qiagen, cat. no. 28104).

24. Electrophoretic apparatus for resolving agarose gels (Owl Scientific or similar).

0 0

Post a comment