Split Genes and Other Characteristics of Nanoarchaeum equitans

Nanoarchaeum equitans, a particularly unusual hyperther-mophilic archaeon, was isolated from a submarine hot vent and subsequently characterised. It is a parasite of another archaeon and displays a number of truly exceptional characteristics, e.g., its ribosomal RNA sequence does not contain the typical oligomeric sequences found in other Archaea. On the basis of the uniqueness of its rRNA sequence, N. equitans has been classified as the first representative of a new phylum of Archaea, the Nanoarchaeota.8

The sequence ofthe N. equitans genome shows that this organism possesses the following truly unique traits: (i) N. equitans has an unusually high number of split genes, at least ten encoding proteins and 6 encoding tRNA molecules (Fig. 13.1).9,10 The ten protein encoding genes are completely split into two pieces, one for the N-terminal portion and the other for the C-terminal portion ofthe

*Massimo Di Giulio—Laboratory of Molecular Evolution, Institute of Genetics and Biophysics 'Adriano Buzzati Traverso', CNR, Via P. Castellino, 111, 80131 Naples, Napoli, Italy. Email: [email protected]

Figure 13.1. An example of tRNA half genes in the N. equitans genome. Position-1 in the boxed sequence of the 5' half tRNATrp(CCA) corresponds to base 308,963 on the plus DNA strand and that of the 3' half corresponds to base 380,364 on the minus DNA strand.10

5' tRNATrp(CCA)

5' gaatctcjgggccggtagctcagcctggttagagcggcggtggccat^ccccctttaaattt 3'

3' tRNATrp(CCA)

5'ggatggccgccgaggctctCaacccgcaggtccggggttcgaatccccgccggcccjgtgg 3'

protein. These genes occupy noncontiguous regions in the genome. The same is true for the six genes for the tRNAs whose 5' and 3' halves are codified on completely different noncontiguous genes. Such split genes for tRNA half molecules have been identified so far only in N. equitans910 while split genes for proteins have been observed also in other Archaea but never in such high numbers.9 (ii) Another unusual characteristic of the N. equitans genome is the lack of operons. The operons conserved in all other Archaea are completely absent from N. equitans; the corresponding proteins are present in nearly full complements but are encoded by scattered genes.9 Even the super-operon ofribosomal proteins, the largest gene array that is conserved to varying extents in all Archaea and Bacteria, is almost completely absent except for a few minor instances.

Phylogenetic analyses have placed N. equitans as the deepest branch in the Archaea domain on the SSU RNA tree,9 in the Euryarchaeota on the SSU RNA tree,11 or as the deepest branch of the Crenarchaeota on the tRNA tree.12

+1 0

Post a comment