Aug

Figure 16.2. Secondary structure involved in chloramphenicol induction of cat mRNA translation. The Shine-Dalgarno sequence of the cat message is firmly closed by base pairing with the end of the preceding short ORF, this preventing the independent initiation of cat translation. In the absence of chloramphenicol, ribosomes read the upstream ORF till UAA and unwind the helix but shield the cat RBS by themselves due to too short distance between the UAA and the RBS. In the presence of chloramphenicol, ribosomes reading the upstream ORF are stalled before reaching the termination codon (by some reasons, the preferential stalling point is the sixth codon of the ORF); in this situation the helix is already unwound by the stalled ribosome and, therefore, the cat RBS (its SD sequence) is open for initiation. (Reproduced, with modifications, from M.H. de Smit & J. van Duin, Prog. Nucl. Acid Res. Mol. Biol. 38, 135, 1990, with permission).

U_A c_gj start ermC

u-a u-a start leader peptide g-u u-a 5' auuuuauaaggaggaaaaaalhbsggcauuuuuaguauuuuuguaaucagcaca cguuaauaagcaaaa cgagaaaaauauaaaacacag aa ag active

0 0

Post a comment