Bu c

a-u u-a u-a g-c start leader peptide stop g-c start ermC

5' auuuuauaaggaggaaaaaalhmggcauuuuuaguauuuuuguaaucagcacaguucauuaucaaccaaacaaaaaauaag aauuaaag agggijij at j aecbba acg ag a a a

Figure 16.3. Secondary structures involved in translational regulation of the synthesis of 23S ribosomal RNA methylase on erm mRNA. The synthesis of the methylase is induced by erythromycin resulting in the methylation of a specific position of the RNA conferring the erythromycin resistance to ribosomes.

A: Inactive structure. In the absence of erythromycin, ribosomes translate the leader cistron, and cannot initiate translation of the erm cistron because of the stable pairing between its RBS (strand 4) and the preceding spacer sequence (strand 3).

B: Active structure induced by erythromycin-stalled ribosomes. In the presence of erythromycin, a stalled ribosome in the leader message covers strand 1 and thus releases strand 2 for pairing with strand 3. As a result, strand 4 becomes unpaired and erm RBS opened.

(Reproduced, with modifications, from M.H. de Smit & J. van Duin, Prog. Nucl. Acid Res. Mol. Biol. 38, 1-35,1990, with permission).

its termination codon opens the cat RBS but interferes with the binding of free ribosomes to the opened cat RBS due to too short distance between the termination site and the cat RBS. In the presence of chloramphenicol the ribosome translating the first cistron will be stalled by the drug; the ribosome stalled in the middle of the short coding sequence supports the unwound state of the intercistronic hairpin and thus opens the cat RBS for initiation.

Another example is the regulation of the synthesis of a specific methylase that modifies A2058 in the ribosomal 23 S RNA and thus confers the resistance against erythromycin (and other microlides, lincosamides and streptogramin B) to the bacterial ribosome (Section 11.3.3). The model of the regulation is as follows (Fig. 16.3). Again a short open reading frame precedes the erm cistron which encodes for the methylase. The erm RBS is closed in the hairpin (designated as 3-4 hairpin). In the absence of erythromycin ribosomes translate only the preceding cistron, which ends within another hairpin (1-2 hairpin) located at some distance upstream of the erm cistron, and do not open the erm RBS. In the presence of the antibiotic the ribosome translating the preceding cistron is stalled in the position around the middle of the coding sequence; as a result the hairpin 1-2 is unwound and the left strand 1 of it is covered by the stalling ribosome. Because of the complementarity between the strand 2 and the left strand 3 of the erm RBS hairpin 3-4, the rearrangement with the formation of the hairpin 2-3 and the release of the erm RBS takes place. Now free ribosomes can initiate translation of the erm cistron and start to synthesise the methylase.

16.3.2.Sequential Translation of Polycistronic Messages via Reinitiation

The longest polycistronic mRNA among those encoding for ribosomal proteins in E. coli is that starting with protein S10 message (see below, Fig. 16.7). It contains messages for 11 ribosomal proteins. However, they cannot bind the initiating ribosomal particles independently. They are translated sequentially: the association with initiating ribosomal particles takes place at the first cistron (S10), the ribosomes initiate translation and move downstream, and then the ribosomes that have terminated the translation of the preceding cistron do not dissociate from the template but pass to reinitiation at the next cistron. It is believed that such sequential translation of the messages of the same polycistronic mRNA provides for the equimolar production of the ribosomal proteins coded by the polycistronic mRNA (see, e.g., Dean & Nomura, 1980; Nomura et al., 1984). Similar situation is observed with the mRNA starting with protein L14 message (see Fig. 16.7) but in this case the sequential translation begins from protein L5 cistron whereas the two preceding messages are read out independently.

The tight and efficient translational coupling via termination - reinitiation requires at least three conditions: (1) the distance between the site of termination of the preceding cistron and the restart site must be short, (2) stable secondary/tertiary structure in the intercistronic region should be absent or melted by ribosomes translating the preceding cistron, and (3) the Shine-Dalgarno sequence should be present prior to the reinitiation site. Termination and reinitiation sites can be in different reading frames (phases) along mRNA. It is interesting that the termination and initiation codons can overlap, or even the RBS of the next cistron can be upstream of the termination codon of the preceding cistron.

For instance, in the polycistronic transcript of trp operon of E. coli,

0 0

Post a comment