Info

Figure 16.4. Coding regions (RNA cistrons) in bacteriophage MS2 RNA (W. Fiers, R. Contreras, F. Duerinck, G. Haegeman, D. Iserentant, J. Merregaert, W. Min Jou, F. Molemans, A. Raeymaekers, A. Van den Berghe, G. Volckaert & M. Ysebaert, Nature 260, 500-507, 1976; R.A. Kastelein, E. Remaut, W. Fiers & J. van Duin, Nature 295, 35-41, 1982).

16.4. Translational Repression

Except the cases of regulation of the synthesis of some antibiotic-resistance factors (chloramphenicol acetyltransferase and 23S RNA methylase, see Section 16.3.1), all the above-discussed mechanisms control translation by determining fixed (constitutive) rates of initiation at various mRNAs and their functional sections (cistrons). In contrast, repression mechanisms with the participation of special RNA-binding proteins called translational repressors provide the ways for modulating the rates of initiation in wide ranges depending on external signals (effectors), as well as for feed-back regulations.

The predominant mechanism of translational repression consists in the direct binding of a repressory protein to a ribosome binding site (RBS). The bound protein competes with the binding of ribosomes at the RBS. When RBS is located within an unstable secondary structure element, a repressory protein can stabilise this element and thus prevent the interaction of the RBS with the initiating ribosome. Sometimes a repressory protein binds to a region outside RBS and induces such a rearrangement of a secondary/tertiary structure that RBS becomes closed and inaccessible for initiating ribosomes. The region of mRNA that binds a repressor can be called translational operator.

16.4.1.Regulation of Translation of Bacteriophage MS2 RNA

The bacteriophage MS2 has a spherical shape; its diameter is 250 Á, its molecular mass 3.6 x 106 daltons. The phage particle contains 180 coat protein subunits, each with a molecular mass of 14,700 daltons, one molecule of the so-called A protein having a molecular mass of 38,000 daltons, and one molecule of RNA with a molecular mass of about 106 daltons. After infecting the E. coli cells or in a cell-free translation system, the phage RNA serves as a template for the synthesis of coat protein, A protein, lysis peptide and a subunit of RNA replicase with a molecular mass of 62,000 daltons (this subunit and lysis peptide are not components of the phage particle). The location of corresponding cistrons C, A, L and S along the MS2 RNA chain is shown schematically in Fig. 16.4.

The chain starts from G, bearing triphosphate at its 5'-position. This is followed by a noncoding sequence with a length of 129 nucleotide residues; this sequence contains AUG and GUG triplets which, however, do not serve as initiation codons. The first initiation codon, GUG, starts the coding sequence of the A cistron corresponding to the A protein. The A cistron is 1179 nucleotide residues in length and ends with the UAG termination triplet. It is followed by a noncoding region 26 residues long. The next coding sequence starts from AUG and is 390 nucleotides in length; this is the C cistron coding for coat protein. This cistron is terminated by UAA and followed by the second termination codon UAG. The C cistron is separated from the S cistron, which codes for RNA replicase subunit, by 36 nucleotides. The S cistron begins with AUG, is 1635 nucleotides in length, and ends with UAG. At a distance of one nucleotide from its termination signal, i.e. out of the reading frame, is found yet another termination triplet, UGA. The 3'-terminal noncoding sequence has a total length of 174 nucleotide residues and ends with an adenosine.

In addition to the three sequentially arranged cistrons A, C and S separated by intercistronic spacers, there is the forth coding sequence L overlapping the C and S cistrons and being in another reading frame (Fig. 16.4); it codes for the lysis peptide, or L protein. This protein is involved in host cell lysis at the late stage of infection. The L cistron begins within the end section of the C cistron, contains the entire 36 nucleotide spacer between C and S, and terminates within the S cistron; the reading frame of the L cistron is shifted to the right by one residue (+1 shift), so that this cistron is not translated during S protein or C protein synthesis. The L cistron has its own initiation codon AUG, which is out of frame with C cistron codons, and its own termination codon UAA, which is out of frame with the codons belonging to the S cistron (Fig. 16.5).

The three sequentially arranged cistrons A, C and S have strong RBS and their translation is initiated by free ribosomes, independent of termination of a preceding cistron. In contrast, the L cistron is translated only as a result of a low level reinitiation after termination of translation of the C cistron and the subsequent "phaseless wandering" (see above, Section 16.3.2). Despite a high potential of their own initiation, the three nonoverlapping cistrons, A, C and S, are strongly dependent on each other in their translation. As already mentioned, the A cistron and the S cistron of untranslated MS2 RNA are incapable of binding ribosomes because their RBSes are masked in secondary/tertiary structures of the RNA. Only the RBS of the C cistron is exposed for immediate interaction with free ribosomal particles and thus can be involved in the initiation of translation, independent of the translation of other cistrons.

In accordance with the above, the translation of MS2 RNA begins with the initiation of the coat lysis protein

__met glu ihr arg phe pro gln gln ser gln gln thr pro ala ser cia a g gui c ii c c ii a A a A GBMWG a A a c c c g a II II c c c ii c A g c a A II c 0 c a g c A a a c u c c g g c a ii c gln gly leu leu lys asp gly asn pro he pro ser ala ile ala ala asn ser gly ile coat protein j7b thr asn arg arg arg pro phe lys his glu asp tyr pro cys arg arg gln gln arg ser u a cijaa.u agacgccggccauucaaacau g[a g g älu u a c c c b—w 11 cgaagacaacaaagaag tyr i met ser lys thr thr lys lys replicase

ser thr leu tyr val leu ile phe leu ala ile phe leu ser lys phe thr asn gln leu |

£ uucaacucuuuauguauugaucuuccucgcgaucuuucucucgaaauuuaccaaucaauu *

phe asn ser leu cys ile asp leu pro arg asp leu ser leu glu ile tyr gln ser ile w leu leu ser leu leu glu ala val ile arg thr val thr thr leu gln gln leu leu thr i gcuucugucgcuacuggaagcggugauccgcacagugacgacuuuacagcaauugcuuac ulu a a.

ala ser val ala thr gly ser gly asp pro his ser asp asp phe thr ala ile ala tyr leu

0 0

Post a comment