Box DNA sequencing

In 1977 Maxam and Gilbert published a DNA sequencing method based on different chemical modifications of DNA (such as dimethyl sulphate) which then allowed cleavage of the DNA only at specific bases (Maxam and Gilbert 1977). The DNA was radio labelled and visualized by electrophoresis on a polyacrylamide gel, generating a ladder of fragments of different lengths terminating for example at 'A' nucleotides. Depending on the specific chemical modification used, other bases could be preferentially cleaved, for example purines (giving a G+A ladder), or pyrimidines (C+Ts).

The 'plus/minus' method of Sanger involved enzymatic synthesis of a new DNA strand from a single-stranded template using DNA polymerase and a specific primer. The synthesis terminated in the absence of a particular nucleoside in the reaction mix, the plus reaction for example containing one nucleoside with the minus reaction containing the other three (Sanger and Coulson 1975).

Subsequently the chain terminator or dideoxy method was established using all four deoxynucle-otide triphosphates (dNTPs) and a small amount of a specific dideoxynucleotide (ddNTP) which on random incorporation into the extending DNA strand would terminate its synthesis (as they lack the necessary 3' OH needed to form a phospho-diester bond between nucleotides) (Sanger et al. 1977) (Fig. 1.8). Radioactive labelling of the primer allowed sequence determination on size separation using a denaturing polyacrylamide gel.

In a short space of time following development of these sequencing technologies the human mitochon-drial genome was sequenced (16.5 kilobases (kb) in length) followed by a series of viral genomes. The use of fluorophores for primer labelling in enzymatic sequencing in 1986 (Smith et al. 1986) (or to label each ddNTP) set the stage for automation in detection and high throughput sequencing, culminating in publication of the draft human genome sequence in 2001 (Section 1.4.2) (Lander et al. 2001; Venter et al. 2001).

- TACCATCAGCGGGACTGTACTGCCTATCGCA 3' I I I I I I I I I I I I I I I I

Primer

Was this article helpful?

0 0

Post a comment