Fdk

T G A A G A G [email protected] TCCTCAGTCTACGTGGTACCA

Figure 1.6 Bases, nucleosides, and nucleotides. The basic repeating units of DNA are nucleotides, shown here as a DNA sequence (from the HBB gene, encoding p haemoglobin) within which one nucleotide is circled ('A'). Nucleosides comprise a sugar residue (deoxyribose, a five carbon sugar), which is covalently linked to a nitrogenous base. In DNA there are four types of nitrogenous base: adenine (A), guanine (G), cytosine (C), and thymine (T); these are classified as either purines (A and G; designated as 'R') or pyrimidines (C and T; designated as Y). Purines consist of two interlocked heterocyclic rings of carbon and nitrogen atoms, pyrimidines of one heterocyclic ring. Sugar residues are linked by covalent phosphodiester bonds, from the carbon atom 3' of a sugar to the carbon atom 5' of the next sugar residue. Nucleotides are nucleosides with a phosphate group attached.

Was this article helpful?

0 0

Post a comment