Info

Non-truncated (G allele)

Truncated (A allele)

GATCTGAAGGTGGTAGGTAAGAATTCTAGAT Î

gatctgaaggtggtaAgtaagaattctagat

Figure 12.15 Identification of a functional polymorphism of BTNL2 in sarcoidosis. The stepwise approach from genome-wise linkage analysis to fine mapping is shown. The exonic structure of BTNL2 is shown with the site of the functional SNP, rs2076530, indicated. Shaded regions denote coding sequence. The four underlined base pairs are those excluded from the spliced mRNA transcript derived from the A allele, resulting in recruitment of an alternative splice site, a frameshift, and premature stop after five codons. Redrawn and reprinted from Traherne et al. (2006a), with permission from Oxford University Press; and from Macmillan Publishers Ltd: Nature Genetics (Valentonyte et al. 2005), copyright 2005.

Was this article helpful?

0 0

Post a comment