J

Human Mar. 2006 chr11:5,204,800-5,204,830 (31 bp)

chrll: 5204805 5204810 5204815 5204820 5204825 5204830

5' ACTTCTCCTCAGGAGTCAGATGCACCATGGT 3'

3' TGAAGAGGAGTCCTCAGTCTACGTGGTACCA 5'

Contig

Gene HBB Chromosome band

<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<

Direction of transcription

— 11 15 chromosome

short (p) arm chromosome

Chromosome bands on chromosome 11

Localised by FISH Mapping Clones. HBB shown at 11p15.4

HBB gene on chromosome 11

Direction of transcription

Exon 3

Direction of transcription

Exon 3

Figure 1.9 DNA sequence from HBB gene showing location and identifiers. Genomic DNA sequence from chromosome 11, located at 5 204 800 bp from the end of the p arm is shown. This is the March 2006 human reference sequence (NCBI build 36.1), which is a 'finished' highly accurate sequence with less than one error on average per 10 000 bases. The reference sequence used here is 'contig NT_009237'; a contig is a contiguous stretch of DNA sequence without gaps assembled using direct sequencing information. Of note, the HBB gene is orientated and transcribed in a centromeric to telomeric direction which is in the opposite direction to the numbering of the reference human genome sequence. The portion of the figure showing sequences and genomic location is adapted from a screenshot of the UCSC Genome Browser (Kent etal. 2002) (http:// genome.ucsc.edu/) (Human March 2006 Assembly).

Was this article helpful?

0 0

Post a comment