Structural variants of haemoglobin and the thalassaemias

Structural variants of haemoglobin are incredibly diverse with over 980 described (http://globin.cse.psu.edu/ hbvar/menu.html) (Giardine et al. 2007). Mainly they arise due to single amino acid substitutions in the globin protein sequence, with a few examples of lengthening or shortening of the globin chain (Fig. 1.21) (Weatherall 2001; Old 2006). Hb S is an example of a structural haemoglobin variant common in sub-Saharan Africa, the Mediterranean, Middle East, and India. Other variants

Genomic y" template strand sequence • non template Gene name

Codons chrlV 5204805 5204810 5204815 5204820 5204825

---> A CTTCTCCTCAGGAGTCAGATGCACCATGGT <--- TGAAGAGGAGTCCTCAGTCTACGTGGTACCA

hRR «««««««««««««J rrrri mn 111111111111111111 ■

rs35198910 rs35699606 rs33932981 rs35497102 rs33926764 rs34387455 rs34948328 rs334 rs33930165 rs34889882 rs34769005 rs33912272 rs34126315 rs713040

Variant responsible for Hb S

0 0

Post a comment