Morphological Diversity Within A Conserved Body Plan

Although some shifts in Hox expression correlate well with transitions in axial patterning (as discussed previously for arthropods, vertebrates, and annelids), morphological diversity also a mouse cgtagcc-cagaaatgccacttttatggccctgtttgtctccctgctct-a baleen whale ..cg...-.c t g g---g chick mouse ggttctgaatggggctgaacaaaacagcagtgcagagctggctagacgtct baleen whale .a c c..-..cg

mouse baleen whale chick gggcttaattgttttatggtttaaataaggtggacactctttcctttga

b neural tube mouse Hoxc8 cis-element baleen whale Hoxc8 cis-element chick Hoxc8 cis-element ci TI LI SI coonnnn

)(5 12 25 31 3500000

mouse paraxial mesoderm mouse Hoxc8 cis-element chick Hoxc8 cis-element

Figure 5.7

Evolutionary changes in the Hoxc8 early c/s-regulatory element

The c/s-regulatory region that controls early axial expression of Hoxc8 is conserved between mammals and birds. (a) Comparison of sequence changes within homologous Hoxc8 early c/s-regulatory elements of a mouse, a baleen whale, and a chick. The extensive sequence identity between these homologous elements is indicated by dots, insertion/deletions are indicated by dashes, and sites that are required for function of the mouse Hoxc8 c/s-regulatory element are indicated with blue boxes. (b) The whale and chick Hoxc8 c/s-regulatory elements direct different expression than the mouse sequence, when tested for activity in transgenic mice. The differences in expression boundaries in the neural tube (top) and paraxial mesoderm (bottom) reflect evolutionary sequence changes in these homologous c/s-regulatory elements. The shift in the expression domain of the whale element in the neural tube and the loss of paraxial expression are caused by a small deletion, which may be compensated for by other sequence changes in the native whale Hoxc8 gene. Neural tube expression is shifted to the anterior relative to the paraxial expression, reflecting the equivalent shift in enervation between the spinal cord and the body.

occurs among more closely related animals that share a particular body plan. The insects, which generally have conserved boundaries of Hox expression domains, exhibit differences in the shape, size, and pattern of their segments and appendages. How have the morphologies of different insects evolved at a genetic level? The answer to this question, again, lies in evolutionary changes in gene regulation.

Three mechanisms are implicated in the diversification of limb patterning between lineages. First, within a stable pattern of Hox gene deployment, regulatory changes downstream of the Hox genes have led to the diversification of the shapes and patterns of homologous limbs. A similar process underlies the evolution of morphological differences between vertebrate forelimbs and hindlimbs. Second, some interesting developmental modulations of Hox expression patterns within fields have morphological and evolutionary consequences. These upstream differences in Hox regulation may provide a glimpse of how larger shifts in Hox expression evolve. Third, some Hox proteins have evolved novel functions and therefore novel patterning roles in different lineages that contribute to morphological diversification.

0 0

Post a comment