Ttgat Tgat

mouse chicken pufferfish mouse chicken pufferfish mouse chicken pufferfish

Figure 8.2

Conservation of a Hox gene c/s-regulatory element in vertebrates

The Hoxb-1 r4 element controls gene expression in rhombomere 4 of several vertebrates. Within this element in the mouse, chicken, and pufferfish, there are three highly conserved repeated sequences (R1-R3) that contain binding sites for the Pbx co-factor. The maintenance of these repeated sequences indicates that strong selective pressures have conserved them throughout a long period of vertebrate evolution. Source: Data from Popperl H, Blenz M, Studer M, et al. Segmental expression of Hoxb-1 is controlled by a highly conserved autoregulatory loop dependent upon exd/pbx. Cell 1995; 81: 1031-1042.

(Fig. 8.3). Given the approximately 60 million years during which these species have been diverging, this finding reveals great functional constraint affecting a long contiguous span of ci's-regulatory DNA.

Some ci's-regulatory elements may even exhibit conservation between phyla. For example, the lab'al gene of Drosoph'la, a member of the same Hox paralogy group as Hoxb1, is autoregulated by a Lab/Exd protein complex. The similar functional sites in the autoregulatory elements of vertebrate Hoxb1 genes and the Drosoph'la lab gene could be due to conservation of an autoregulatory element from their last common ancestor.

The dynamics of sequence turnover in cis-regulatory DNA

The vast evolutionary distances between the taxa in the preceding examples allow us to confirm the significance of the conservation of particular sequences; they do not, however, elucidate the dynamics of ci's-regulatory DNA evolution. For a better picture of that process, we must compare a greater number of more closely related species.

As an example, consider the homologs of the well-studied Drosophila melanogaster even-skipped stripe 2 element (Fig. 8.4a), which have been isolated from a host of other Drosophila species. These elements all drive an accurately positioned stripe of reporter gene expression in the eve stripe 2 domain in D. melanogaster, yet considerable sequence divergence occurs among the elements. Interestingly, some of the sequence changes in the other Drosophtta species abolish sites that are known to be essential in the D. melanogaster element (Fig. 8.4b). For instance, the third Bicoid binding site (bcd-3) and the first Hunchback (hb-1) binding site found in D. melanogaster lack counterparts in D. pseudobscura, D. erecta, and D. yakuba.

Dm-Int2 AATTCCGCAACTCAATGTTGGCTTTGTTTCGCCTCTCCCGCTTTTTGCTAACATTGATTTCGAAGATTTCGCTGTGATTT Dv-Int2 AATTCCGCCAGCAAATGTC-GCTTTGTTTGCGTTCT-----TTTTTGCTAACATTGATTTCGAAGATAT--CTGTGATTT

Dm-Int2 C-TGTGACAAGTACAGAAAAGTTCTCACGATCGCTGGTTTCCAGTGTCCAGTTTCGAGGGCCCAGAACTCAGGCCGACCA Dv-Int2 TTTGTGACAAGTACAGAAAAGTTCTCACGATG--------CCAAAAGCGTCTCACAGTTGCCCAAAAGGGACGCTGAC--

Dm-Int2 TGGTCAAAAGGC----------------GGCTGGCAGTGCGGCCAATATCCATGAGGCAGTTGCCG--------------

Dv-Int2 TGGGCCTG-GGCTCCAGATCGAGATCGAGGCTGAGGTTGAGGC---------TGAGGCTGGGGCCTGGGTCTCCGTCTCC

Dm-Int2 ----------------TTGCTGCTGC-CGCTGGGGCACAAAGAAATTCTTGTGTCGCAAGTTCCAATTGTGCAAGGCCGC

Dv-Int2 GTCTACATTTCGGTGTTTGGAGCTTGTCGCTGTGGCACAAAGAAATTCTTGTGTCGCAAGTTCCAATTGTGCAAGGCCGC

Dm-Int2 GGCACCAAATCGAAATTGGCCTTTTATGTAAGTAACCGATACGACACGATTCTGATTCTATGCTTTTGCATGCCCATAAA Dv-Int2 GGCACCAAATCGAAATTGGCCTTTTATGTAAGTAACCGATACGACACGATTCTGATTCTATGCTTTTGCATGACCATAAA

Dm-Int2 GAGGGACCGCGATAAACCCGCCTGGATATTG---------------------------------------CGGCTTC---

Dv-Int2 GAGGCCCA--GATAAACCCA---GGATCGCCGCACGACGCTCCATTGAGCCGCCAGCCATACGCACGTACCGGCTTAGGG

Dm-Int2 ----GGTTGCTCCTTTCTGCTCCTTTCTGCACCTCCGCCATGGAAAGCCAATCGCAGATTGAGTCAGCAGCTTTGGCTAC

Dv-Int2 TTAGGGTTAGGGTTCGGTGTTGGATTCGGCTCGGCCG---------GCCAATCGCAGATTGAGTCAGCAGCCAGC-----

Dm-Int2 TCAGCTGGA-------------TGACCGGTTTATTTT------GTCCCACAAACGCACAATCCTCGTCCGCCCTTT----

Dv-Int2 ----CTGGTGACCGGTGACCGGTGACCGGTTTATTTGCCCATGGTCTGTGGCTCTGGCCAATGTGCGCACAGTTTTGTCG

Dm-Int2 ------CGACACTTTGGCCAGCCAGCCAGCCAGCCAGTCCCGAAACCTAAAGTTAAACTAAAACAAATAAACAAACCAAA

Dm-Int2 AACCTTGGTCCG--------CTCGGTTAATTTATTGTGTGTATCGCCATTAGTTCTTGCCGATCTTGCAGCTCTCCCCGC

Dv-Int2 --CCTATGCCCGTTCCCTTTCTC TTAATTTATTGTGTGTATCGCCATTACTTCTTGCCGAGC-----------------

Dm-Int2 CTACAACGCCATAACATAACCATACCGATTCGATCCTTGGGACCTTTTGTCAACCGA-TCGCAGATAAACCA Dv-Int2 -------------ACATCAAAACGGCGAGCGAGCCCGAGCTGCGATCAGATAACCCCGTCGCAGCAAAACCTGCA

Figure 8.3

Extensive conservation of a c/s-regulatory element between highly diverged Drosophila species

The boundary enhancer from the vestigial gene of D. melanogaster and D. vlrllls controls gene expression on the dorsoventral boundary of the developing wing field. Alignment of the sequences of the two elements reveals extensive regions of perfect sequence conservation. This pattern of "islands" of sequence conservation between c/s-regulatory elements is typical of functionally conserved elements between well-diverged species, although the length of certain conserved regions is extraordinary in this example. Source: Williams JA, Paddock K, Vorwerk K, Carroll SB. Organization of wing formation and induction of a wing-patterning gene at the dorsal/ventral compartment boundary. Nature 1994; 368: 299-305.

The bcd-3 site is required for proper eve stripe 2 formation in D. melanogaster. This analysis suggests that the bcd-3 site may be a new site in D. melanogaster, whose function became essential in the context of other changes within the element.

Of the 17 known binding sites for transcriptional regulators in this element in D. melanogaster, only three are perfectly conserved among the other Drosophila species studied (Fig. 8.4b). Thus most binding sites exhibit a considerable degree of substitution. As each full element from the heterologous species drives an accurate eve 2 stripe in D. melanogaster, it appears that the various changes in binding sites compensate for one another, such that the net output of the element is the same (in D. melanogaster).

One evolutionary explanation for the observed pattern of functional conservation and sequence changes in the eve stripe 2 enhancer is that stabilizing selection governs the

0 0

Post a comment