RNA Aptamers that Recognize the Cell Surface of Live Trypanosomes

T. brucei was the first protozoan parasite that was targeted using SELEX technology. Homann and Goringer (1999) used African trypanosomes as a model system for the selection of aptamers to the surface of live parasites. The SELEX experiments were designed to identify high-affinity RNA ligands to variant as well as invariant molecules on the parasite surface. Such aptamers might interfere with surface protein function and have the potential to re-direct the immune response to the surface of the parasite. Other aptamers could potentially be used for the affinity isolation of previously unknown surface proteins.

Two separate SELEX experiments were performed in parallel using the bloodstream lifecycle stages of T. brucei strains MITat 1.2 and MITat 1.4 as targets (Cross 1975). The two parasite cell lines show variant specific characteristics, among them the stable expression of different VSG variants: VSG 221 in the case of MITat 1.2 and VSG 117 for MITat 1.4. The starting RNA library contained 2x1015 unique 85-mer RNA sequences with a central segment of 40 randomized nucleotide positions. In each cycle, living bloodstream stage cells were incubated with the pools of RNA molecules to allow the enrichment of RNA sequence variants that recognize exposed surface structures. After 12 cycles of binding, reverse transcription and amplification, the "winner" sequences were identified by cloning and sequencing. Together, 106 clones were analysed and three aptamer families were identified based on conserved sequence motifs and secondary structure elements (Fig. 2a).

Individual aptamers from each family were chosen for the identification of their interaction partners by zero-distance photo cross-linking (Fig. 2b). None of the aptamers was able to discriminate between MITat 1.2 and MITat 1.4 parasites, suggesting invariant surface elements as aptamer targets. One of the aptamers of family I (aptamer 2-16) was selected as a representative of this group and was characterized further. According to secondary structure prediction and enzymatic structure probing experiments, aptamer 2-16 folds into a pseudoknotted hairpin and assumes a compact, almost globular fold (Fig. 3). The ability to form this pseudoknotted hairpin seems to be an important determinant for the high-affinity interaction, since shortened, "non-pseudoknotted" variants of the RNA showed significantly reduced surface binding (Homann and Goringer 1999). Aptamer 2-16 bound to MITat 1.2 and MITat 1.4 cells with similar high affinities (Kd) of 60 nM. The aptamer target was identified by zero distance photo cross-linking as a 40-42 kDa pro-

family I

2-16 tcgggtggcc 2-26 atcttggctgac 2-17 ctagcagc

4-34 tccaatcttc 4-47 tcacacgggc family I

2-16 tcgggtggcc 2-26 atcttggctgac 2-17 ctagcagc

4-34 tccaatcttc 4-47 tcacacgggc

cgt

gtct

gagcgg

cgt

ggtgt

gggcgg

cgt

gtgg

gagcgg

cgt

agtg

cagcgt

cgt

gaacg

cagcga

ggacggccacttgagcgc aaccgtcggctgagatac ccacgtgcgtggacttc gcctgaaggttggagcag gttcgcccgtcgtgacatt ggacggccacttgagcgc aaccgtcggctgagatac ccacgtgcgtggacttc gcctgaaggttggagcag gttcgcccgtcgtgacatt kDa vz^ o<*

family II

2-5 ctcaagtcggagtcgcctgggatgggtctggga gggagtg 2-10 gacagcccgccaacctggga ggga gggg gggtatggtttg

4-29 cggcagccggccaggga ggga gggctgggggtgc

4-30 gagcagtcccacagcgccgcgggc gga gggaaggggag orphans

2-29 agtaaaccggcccctgcttcgagcagataagtgccgaa 4-9 gccgagaggtgcctgcttcgagctgtaagggacgat 4-22 agcttaaccggccctgagcctgctctgtaagcgccaac 4-19 ccctcgtgaacccgcggctagccaactagcgacggataa

Fig. 2 a Aligned DNA sequences of RNA aptamer families specific for the T. brucei surface (Homann and Göringer 1999; Homann and Göringer 2001). Consensus sequence elements are shown in shaded boxes. b UV-crosslinking of radioactively labelled RNA aptamers from all three families to live parasites. The aptamers interact with different surface proteins as indicated by the arrows kDa vz^ o<*

Fig. 3a-c Secondary structures of three T. brucei-specific RNA aptamers. a Aptamer 2-16 (Homann and Göringer 1999). b Aptamer N2 (unpublished). c Aptamer cl57 (Lorger et al. 2003). The 2D models were derived from secondary structure prediction and enzymatic probing experiments. The 3D models were created by molecular modelling followed by energy minimization

Fig. 3a-c Secondary structures of three T. brucei-specific RNA aptamers. a Aptamer 2-16 (Homann and Göringer 1999). b Aptamer N2 (unpublished). c Aptamer cl57 (Lorger et al. 2003). The 2D models were derived from secondary structure prediction and enzymatic probing experiments. The 3D models were created by molecular modelling followed by energy minimization tein that is present on bloodstream-stage parasites but not on the surface of insect-stage trypanosomes. Using fluorescently labelled aptamer preparations in in situ localization experiments, the 42-kDa protein was identified as a component of the flagellar pocket (FP) of the parasite. The FP represents the main endo/exocytosis site of the trypanosome cell.

These results demonstrated that living parasite cells are suitable targets for SELEX experiments that are aimed at the identification of high-affinity ligands to surface components. The experiment further verified that specific RNA ligands can be selected without any knowledge of the cell's surface architecture

(Fig. 3) and it demonstrated the potential of SELEX technology to function as a mapping tool for cellular targets of unknown composition as suggested before (Morris et al. 1998; Ulrich et al. 2001).

Aside from their potential as identification tools, aptamers themselves may be used as therapeutic reagents against infectious protozoan parasites. In order to test the therapeutic potential of the selected RNA ligands (Homann and Goringer 1999), the above-described aptamer 2-16 was chosen for a further analysis with respect to its stability and fate after binding to the parasite cells.

Fluorescently labelled aptamer preparations were used to visualize RNA binding to the 42-kDa flagellar pocket polypeptide. Interaction with its target was followed by rapid endocytotic uptake and intracellular transport to the lysosome (Homann and Goringer 2001; Fig. 4). Co-localization experiments with transferrin suggested a receptor-mediated uptake pathway followed by vesicular routing to the lysosome. The aptamer was partially degraded during the uptake process; however, a core structure of about 50 nt proved significantly more stable towards RNase activities within the flagellar pocket and endosomal vesicles. Binding and uptake was sequence specific and was not observed with RNA molecules of random sequence. Thus, the specificity of binding and uptake suggested that aptamer 2-16 could be used for a trypanosome-specific delivery of RNA-coupled compounds to the lysosomal compartments of the parasite (see Sect. 4.2, "Piggy-Back Approach" below).

Fig. 4a-c Targeting aptamer-conjugated biotin molecules to the lysosome of African try-panosomes. Aptamer 2-16 (Homann and Goringer 1999; Homann and Goringer 2001) was covalently modified with a biotin moiety and the biotin group was detected with a fluorophore-conjugated anti-biotin antibody (arrowheads). a Initial binding occurs in the flagellar pocket (FP) of the parasite. b At later time points the signal is detected within endosomal vesicles (E) and finally accumulates (c) within the lysosome (L). K indicates the position of the kinetoplast; N represents the nucleus

Fig. 4a-c Targeting aptamer-conjugated biotin molecules to the lysosome of African try-panosomes. Aptamer 2-16 (Homann and Goringer 1999; Homann and Goringer 2001) was covalently modified with a biotin moiety and the biotin group was detected with a fluorophore-conjugated anti-biotin antibody (arrowheads). a Initial binding occurs in the flagellar pocket (FP) of the parasite. b At later time points the signal is detected within endosomal vesicles (E) and finally accumulates (c) within the lysosome (L). K indicates the position of the kinetoplast; N represents the nucleus

Was this article helpful?

0 0

Post a comment